CB1 MedChemExpress Nclature initiative (20). The corresponding gene in Dictyostelium now bears the name
Nclature initiative (20). The corresponding gene in Dictyostelium now bears the name plnA. For labeling the N-terminal end of perilipin with GFP, primers 159 (CGTGTCGACATGTCATCT CAAGAACAACAAAAATCAAAGC) and 160 (CGTGGATCCATCTAAT TGGTTGAGTTATCATTTGAAGATGAAG) had been employed for PCR around the cDNA clone SLE 217 obtained in the Dictyostelium cDNA project in Japan at Tsukuba University, and also the SalI/BamHI-doubly digested item was integrated into vector 68. As a basis for further cloning measures, the coding sequence of smtA was amplified with primers 674 (CCATAGAATTCAAAATGAATACTCAAC AACGTGCTATGG) and 675 (CCATAGAATTCTTAATCAGTGCTTGG TTTACGACATAATAAG) using reverse-transcribed mRNA of AX2 because the template after which ligated into vector pGem-TEasy by virtue of single A-residue overhangs to yield plasmid 845. Subsequent digestion on the PCR-engineered EcoRI websites allowed insertion with the released fragment into plasmid 68 that now expresses GFP-Smt1 (plasmid 846). The reverse construct is determined by the amplification of smtA lacking its quit codon by primers 258 (CCGAATTCAAAATGAATACTCAACAACG) and 474 (CC GAATTCGATCAGTGCTTGGTTTACG) from genomic DNA and its intermediate cloning into pGEM-TEasy (plasmid 759), from where it was excised with EcoRI and transferred into vector 48 to yield 760 expressing Smt1-GFP. The novel lipid droplet constituent encoded by ldpA was amplified with primers 302 (CGGGATCCAAAATGAATACTTCAACAACAAC) and 303 (CCGAATTCTTAATTACGTTTATTTTTTTTACC) using genomic DNA of AX2 as the template, cleaved with BamHI and EcoRI, and then ligated into vector 68 so that a GFP-Ldp hybrid protein is expressed from plasmid 581. The complementary construct 571 making Ldp-GFP is based on vector 48 that received a PCR product from primers 304 (CCGAATTCAAAAT GAATACTTCAACAACAAC) and 305 (CCGGATCCATTACGTTTATT TTTTTTACCC). To construct a C-terminally tagged version on the Dictyostelium Net4 homologue, a gene-specific PCR was performed on total cDNA with a BACE1 Molecular Weight combination of primers 614 (GGCCGAATTCAAAATGGGTGCCCAA) and 615 (GGCCGGATCCTTTATTTTGTAATTTTTTC), purified, and cut with EcoRI and BamHI before ligation into the same internet sites of vector 48, resulting in plasmid 809 that serves to express Net4-GFP. A different set of primers, 618 (GGCCGTCGACATGGGTGCCCAAAAATTAC) and 619 (GGCCGAATTCTTATTTATTTTGTAAT), yielded a solution appropriate for insertion into plasmid 68 following digestion with SalI and EcoRI. This cloning step yielded plasmid 810 (GFP-Net4). The above constructs were transformed into Dictyostelium discoideum AX2 vegetative cells (referred to as the wild kind) by electroporation. Transformants were selected by virtue of G418 resistance, and person clones were derived by spreading dilutions on bacterial lawns. Two or much more clones originating from separate transformation events and displaying the exact same patterns of florescence distribution had been conserved. The localization of tagged proteins towards the endoplasmic reticulum was confirmed by indirect immunofluorescence (21) applying mouse monoclonal antibodies (MAbs) raised against the protein disulfide isomerase (PDI) (MAb 221-64-1) (22). The lipid droplet-specific dye LD540 (23) was diluted from its stock (0.5 mg/ml in ethanol) to a final concentration of 0.1 g/ml in phosphate-buffered saline (PBS) and applied to stain fixed cells for 30 min rather of applying an antibody. To be able to stain lipid droplets in living cells, we employed the fluorescent fatty acid analogue C1-BODIPY-C12 (as described in reference 15) or replaced the growth med.
